MrBayes (Bayesian Analysis of Phylogeny)

Run a serial version for small size data

mb

Then follow the instruction on the screen. To quit the program, type q and ENTER. Use quit to quit the program.

quit

Run a parallel version with large data

* for tcsh, csh shell users

source /usr/local/bin/use_mpich.csh
mpirun -np 4 /usr/local/mrbayes/mbp

* for bash shell users

. /usr/local/bin/use_mpich.sh
mpirun -np 4 /usr/local/mrbayes/mbp

Where the "4" in parameter is the number of parallel processes. Users can set to 2 -8 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement.
Then follow the instruction on the screen.

q

To quit the program, type q and ENTER

Run a parallel version with medium size data on interactive node
When running MPI jobs on the rcluster interactive node (inter1), please first create a file host.list.
Refer to Running an Interactive Jobfor details about host.list.
Then run the mpirun command with:

ssh inter1
mpirun -np 4 -machinefile host.list /usr/local/mrbayes/mb

Where the "4" in parameter is the max number of parallel processes at node inter1. Users can set to 2 -4 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement and use queue submit your job.
Then follow the instruction on the screen.

q

To quit the program, type q and ENTER

Run the job in the queue, refer to MrBayes
Below is an example file defines the data. Save this file as e.x. yh.nex

#NEXUS
begin data;
dimensions ntax=12 nchar=898;
format datatype=dna interleave=no gap=-;
matrix
Tarsius_syrichta AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCTCCCTAT
Hylobates ATGCTGAACAACCACCCAGACACTACAACTCTCACTAAGCTT
end;

Define all the parameters in the .par file, e.x. yh.par. Notice the yh.nex is a data file defined above. This example performs three single-run analyses of the data yh.nex.

set autoclose=yes nowarn=yes;
execute yh.nex;
lset nst=6 rates=gamma;
mcmc nruns=1 ngen=10000 samplefreq=10 file=yh.nex1;
mcmc file=yh.nex2;
mcmc file=yh.nex3;

Below is a script subp.sh to the batch queue, yh.par is the file definced above

#!/bin/bash
cd /home/rccstaff/yhuang/iobdemo/mrbayesTest
echo $LSB_HOSTS
cat /dev/null > mlist.$$
for variable in $LSB_HOSTS; do
echo $variable >> mlist.$$
done
mpirun -np 4 -machinefile mlist.$$ /usr/local/mrbayes/mb < yh.par > myout
rm -f mlist.$$

After saved the subp.sh, use following add excute permission to the subp.sh

chmod u+x subp.sh

Then submit all these to the queue as

bsub -n 4 -q r4-24h -o mbtest.out.%J -e mbtest.err.%J ./subp.sh

Commands that are available from the command line or from a MrBayes block include:

About -- Describes the program
Acknowledgments -- Shows program acknowledgments
Charset -- Assigns a group of sites to a set
Charstat -- Shows status of characters
Citations -- Appropriate citation of program
Comparetree -- Compares the trees from two tree files
Constraint -- Defines a constraint on tree topology
Ctype -- Assigns ordering for the characters
Databreaks -- Defines nucleotide pairs (doublets) for stem models
Delete -- Deletes taxa from the analysis
Deroot -- Deroots user tree
Disclaimer -- Describes program disclaimer
Exclude -- Excludes sites from the analysis
Execute -- Executes a file
Help -- Provides detailed description of commands
Include -- Includes sites
Link -- Links parameters across character partitions
Log -- Logs screen output to a file
Lset -- Sets the parameters of the likelihood model
Manual -- Prints a command reference to a text file
Mcmc -- Starts Markov chain Monte Carlo analysis
Mcmcp -- Sets the parameters of a chain (without starting analysis)
Outgroup -- Changes outgroup taxon
Pairs -- Defines nucleotide pairs (doublets) for stem models
Partition -- Assigns a character partition
Plot -- Plots parameters from MCMC analysis
Prset -- Sets the priors for the parameters
Props -- Set proposal probabilities
Quit -- Quits the program
Report -- Controls how model parameters are reported
Restore -- Restores taxa
Root -- Roots user tree
Set -- Sets run conditions and defines active data partition
Showmatrix -- Shows current character matrix
Showmodel -- Shows model settings
Showtree -- Shows user tree
Sump -- Summarizes parameters from MCMC analysis
Sumt -- Summarizes trees from MCMC analysis
Taxastat -- Shows status of taxa
Taxset -- Assigns a group of taxa to a set
Unlink -- Unlinks parameters across character partitions
Usertree -- Defines a single user tree
Version -- Shows program version

Commands that should be in a NEXUS file (data block or trees block) include:

Begin -- Denotes beginning of block in file
Dimensions -- Defines size of character matrix
End -- Denotes end of a block in file
Endblock -- Alternative way of denoting end of a block
Format -- Defines character format in data block
Matrix -- Defines matrix of characters in data block
Translate -- Defines alternative names for taxa
Tree -- Defines a tree from MCMC analysis

Note that this program supports the use of the shortest unambiguous
spelling of the above commands (e.g., "exe" instead of "execute").